Postparser // project smallRNA

Current page: 0/179                                                 

1GCGGTCCTTCATTCCACCGGAGTCTG | 26BLAT!  chr1:209605510-209605532full counts: 2005full reads: 13962049
refGene: LOC642587/209602167/209605892 introns: LOC642587/209603821/209605548 EST: DA691010/209471376/209608975
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
2TAGCTTATCAGACTGATGTTGACT | 24BLAT!  chr17:57918634-57918657full counts: 1067full reads: 6950250
refGene: MIR21/57918626/57918698 introns: 0 EST: BF326048/57918164/57918676
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
3TTCAAGTAATCCAGGATAGGCTTTT | 25BLAT!  chr12:58218462-58218438full counts: 818full reads: 4822924
» show mapping and annotation info!
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
4TGAGGTAGTAGGTTGTATAGTTTA | 24BLAT!  chr11:122017297-122017274full counts: 548full reads: 4259470
» show mapping and annotation info!
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
5CAACGGAATCCCAAAAGCAGCTGTA | 25BLAT!  chr3:49058127-49058104full counts: 871full reads: 4241735
refGene: NDUFAF3/49057907/49060926 introns: NDUFAF3/49058003/49059778 EST: BG772949/49054930/49059561
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
6TGAGATGAAGCACTGTAGCTCTTC | 24BLAT!  chr5:148808541-148808561full counts: 672full reads: 3897772
refGene: LOC728264/148786439/148812399 introns: 0 EST: AW750687/148808284/148808847
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
7TAACACTGTCTGGTAACGATGTTT | 24BLAT!  chr1:1103296-1103318full counts: 1053full reads: 3702674
refGene: MIR200A/1103242/1103332 introns: 0 EST: 0
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
8AAGCTGCCAGTTGAAGAACTGTA | 23BLAT!  chr17:1617229-1617208full counts: 504full reads: 3140542
refGene: C17orf91/1614797/1619566 introns: 0 EST: AV763335/1253358/1732163
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
9TGAGGTAGTAGGTTGTGTGGTTTTT | 25BLAT!  chr22:46509571-46509593full counts: 943full reads: 3094888
refGene: LOC400931/46481876/46509808 introns: 0 EST: AI382133/46509384/46509808
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)
10CGTACGGGTTTAAACTTCGA | 20BLAT!  chr2:177354352-177354339full counts: 283full reads: 2494375
refGene: 0 introns: 0 EST: 0
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   ∅ (comments)             Unknown MIR: (comments)
11TAATACTGCCGGGTAATGATGGAAA | 25BLAT!  chr12:7072905-7072927full counts: 530full reads: 2279241
refGene: MIR200C/7072861/7072929 introns: 0 EST: BU860272/7072407/7085058
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
12TGAGGTAGTAGATTGTATAGTTA | 23BLAT!  chrX:53584228-53584207full counts: 451full reads: 2095851
» show mapping and annotation info!
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
13AACATTCAACGCTGTCGGTGAGTTT | 25BLAT!  chr1:198828259-198828235full counts: 495full reads: 1986765
» show mapping and annotation info!
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
14TGTAAACATCCCCGACTGGAAGCTT | 25BLAT!  chr8:135817183-135817160full counts: 508full reads: 1478042
refGene: MIR30D/135817118/135817188 introns: 0 EST: AA137041/135816968/135817381
» show library info!
» comment on this!
Micro RNA indicator: (refGene)   (comments)             Unknown MIR: ∅ (comments)
15TTCACAGTGGCTAAGTTCTGCAAT | 24BLAT!  chr9:97847787-97847808full counts: 341full reads: 1598574
» show mapping and annotation info!
» show library info!
» comment on this!
Micro RNA indicator: ∅ (refGene)   (comments)             Unknown MIR: ∅ (comments)

Current page: 0/179